Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001275 | |||
Gene | PLCL2 | Organism | Human |
Genome Locus | chr3:17059499-17059748:- | Build | hg19 |
Disease | Postmenopausal Osteoporosis | ICD-10 | Endometriosis of uterus (M81.0) |
DBLink | Link to database | PMID | 29742503 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | 58 menopausal patients with 41 control menopausal women |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TCTTCTTCTCCACTCCTGAA ReverseGAGCAAGGGCCCTAGCTCAA | Statistics | Fold Change : Upregulated,3.3053839 pvalue : p=0.034438204 |
Citation | |||
Zhao, K, Zhao, Q, Guo, Z, Chen, Z, Hu, Y, Su, J, Chen, L, He, Z, Cai, X, Chen, M, Zheng, L, Wang, W, Wang, Q (2018). Hsa_Circ_0001275: A Potential Novel Diagnostic Biomarker for Postmenopausal Osteoporosis. Cell. Physiol. Biochem., 46, 6:2508-2516. |